algorithms image lab software bio rad imagej nih rrid scr 001935 url (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
algorithms image lab software bio rad imagej nih rrid scr 001935 url
Algorithms Image Lab Software Bio Rad Imagej Nih Rrid Scr 001935 Url, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36433 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+nih/Image+Lab+Software/pm41512867-588-28-32
Average 99 stars, based on 36433 article reviews
Algorithms Image Lab Software Bio Rad Imagej Nih Rrid Scr 001935 Url, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36433 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/algorithms+imagej+nih/Image+Lab+Software/pm41512867-588-28-32
Average 99 stars, based on 36433 article reviews
algorithms image lab software bio rad imagej nih rrid scr 001935 url - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
other:Article Title: JLP/Foxk1/N-cadherin axis fosters a partial epithelial-mesenchymal transition state in epithelial tubular cells Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies JLP Abcam Cat#ab12331 Foxk1 Abcam Cat#ab18196 Foxk1 Santa Cruz Cat#sc-373810 Fibronectin Abcam Cat#ab2413 α-SMA Abcam Cat#ab124964 TGF-β1 Abcam Cat#ab215715 Collagen-I Abcam Cat#ab138492 Ki67 Abcam Cat#ab16667 phospho-histone H3 (pH3) Abcam Cat#ab80612 Vimentin Cell Signaling Technology (CST) Cat#D21H3 N-cadherin CST Cat#13A9 E-cadherin CST Cat#24E10 Caspase-3 CST Cat#5A1E PARP CST Cat#46D11 GAPDH Proteintech Cat#60004-1-Ig Alexa Fluor 488- and 594-conjugated secondary antibodies Antgene Cat#Ant024/Ant029 Horseradish peroxidase (HRP)-coupled goat anti-mouse/rabbit IgG Antgene Cat#Ant019/Ant020 Bacterial and virus strains Jlp shRNA lentivirus Genechem Co. N/A Foxk1 shRNA lentivirus Genechem Co. N/A Cdh2 shRNA lentivirus Genechem Co. N/A pGL3-N-cadherin-Promoter Biofavor N/A pcDNA3.1-Foxk1 plasmid Biofavor N/A pcDNA3.1-JLP-1 Genechem Co. N/A Biological samples Human kidney tissues from patients with CKD Renmin hospital of Wuhan University N/A Human adjacent normal tissues Renmin hospital of Wuhan University N/A Chemicals, peptides, and recombinant proteins Recombinant human TGF-β1 MCE Cat#HY-P7118 Recombinant human FGF-2 MCE Cat#HY-P7331 Tamoxifen Sigma Cat#T5648 Fetal bovine serum (FBS) Gibco Cat#10099-141 DMEM-F12 Hyclone Cat#SH30023.01 penicillin/streptomycin Hyclone Cat#SV30010 DAPI Sigma Cat#S7113 Tryptic digestion solution Beyotime Cat#C0203 Critical commercial assays Annexin V PE Apoptosis Detection Kit BD Cat#559763 Cell Cycle Detection Kit Antgeen Cat#Ant161 Methylated DNA Capture kit EpiGentek Cat#P-1034-96 OneStep TUNEL Apoptosis Assay Kit Beyotime Cat#C1088 Experimental models: Cell lines HK-2 (human kidney 2) cells ATCC Cat#CBP60447 Experimental models: Strains Ksp1.3-cre mice Jackson Laboratory Cat#012237 Oligonucleotides Primers for RT-qPCR, see Table S1 This paper N/A shRNA sequences for jlp : 5′-CCCAGTGTATCAGTCGAGCAA-3′ This paper N/A shRNA sequences for foxk1 : 5′-CUCUCUUUGAACCGUUACUTT-3′ This paper N/A shRNA sequences for cdh2 : 5′-CTGAGCTCAGTTACACTTGAA-3′ This paper N/A Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Image Lab Bio-Rad Laboratories http://www.bio-rad.com Wafergen WaferGen Inc. http://www.wafergen.com SmartChip qPCR software WaferGen Inc. http://www.wafergen.com FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo/ GraphPad Prism GraphPad https://www.graphpad.com/scientific-software/prism/ Other Mendeley data for original western blot images This paper https://doi.org/10.17632/2f9 rjn74cj.1 Open in a separate window Key resources table . Article Title: A methionine-Mettl3- N 6 -methyladenosine axis promotes polycystic kidney disease Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-METTL3 Abcam ab195352 Anti-METTL3 Invitrogen MA5-27527 Anti-m 6 A Abcam ab151230 Anti-c-Myc Abcam ab185656 Anti-c-Myc Sigma OP10-200UG Anti-Avpr2 EMD AB1797P Anti-Puromycin Developmental Studies Hybridoma Bank PMY-2A4 Anti-HA Cell Signaling #3724 Anti-PCNA Santa Cruz sc-7907 Anti-pHH3 Sigma H0412 Anti-pCreb1 Cell Signaling 9198S Anti-Yap Cell Signaling #4912 Anti-GFP Aves GFP-1020 Anti-DBA Vector Laboratories B-1035 Anti-Mettl14 Sigma HPA038002 Bacterial and Virus Strains Ad-CMV-iCre virus Vector Biolabs #1045 Biological Samples Normal human and ADPKD kidney samples PKD Biomarkers and Biomaterials Core in the Kansas PKD Center at the Kansas University Medical Center (KUMC) Chemicals, Peptides, and Recombinant Proteins Puromycin Invitrogen A1113803 O-Propargyl-Puromycin JenaBioScience NU-931-5 8-Br-cAMP Sigma B7880 alamarBlue Invitrogen DAL1025 methionine Sigma M5308 s-adenosylmethionine Cayman Chemicals 13956 s-adenosylhomocysteine Cayman Chemicals 13603 Critical Commercial Assays m 6 A elisa kit Epigentek P-9005-96 SAM elisa kit Cell Biolabs STA-671-C Magna MeRIPTM m 6 A Kit EMD Millipore 17-10499 Submitted data MeRIP-seq NCBI Gene Expression Omnibus GSE165956 RNA-seq NCBI Gene Expression Omnibus GSE165956 Experimental Models: Organisms/Strains Ksp/Cre Shibazaki et al., 2008 N/A Ksp/rtTA Pan et al., 2013 N/A tetO-Cre Jackson Laboratories Stock No: 006234 Pkd1 F/F Jackson Laboratories Stock No: 010671 Pkd1 RC/RC ( PKD1 p.R3277C) Hopp et al., 2012 N/A Mettl3 F/F UT Southwestern Med Ctr N/A Mettl3 Tg UT Southwestern Med Ctr N/A mIMCD3 cells ATCC CRL 2123 Oligonucleotides siRNA against Mettl3 (UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA) Dharmacon L-049446-01-0020 Scrambled siRNAs (ACAGCAGGCACAGACAGGCAGU) Dharmacon D-001810-10-20 Recombinant DNA Plasmid - CAG-LSL-Mettl3cDNA-HA/HA/HA-IRES-GFP This paper N/A Plasmid - pLightSwitch Empty (pLS) 3′-UTR Switchgear Genomics S890005 Plasmid - pGL3 Promega E1751 Software and Algorithms Imagej NIH https://imagej.nih.gov/ij/ Zen blue software Zen https://www.zeiss.com/microscopy/us/products/microscope-software/zen-lite.html ImageLab Bio-rad https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z Ingenuity Pathway Analysis (IPA) Qiagen https://analysis.ingenuity.com/pa/installer/select Prism Graphpad https://www.graphpad.com/scientific-software/prism/ Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/software/igv/ Open in a separate window KEY RESOURCES TABLE. Article Title: JLP/Foxk1/N-cadherin axis fosters a partial epithelial-mesenchymal transition state in epithelial tubular cells Article Snippet: Slides were observed under an Olympus microscope (Olympus, Tokyo, Japan). Software:Article Title: Molecular mechanisms of snoRNA-IL-15 crosstalk in adipocyte lipolysis and NK cell rejuvenation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus Human FOXP3 siRNA SMARTPool Dharmacon Cat# L-009307-00-0005 ON-TARGETplus Human GATA1 siRNA SMARTPool Dharmacon Cat# L-009610-00-0005 ON-TARGETplus Human GR siRNA SMARTPool Dharmacon Cat# L-003424-00-0005 ON-TARGETplus Human HIF1a siRNA SMARTPool Dharmacon Cat# L-004018-00-0005 ON-TARGETplus Human LXRa siRNA SMARTPool Dharmacon Cat# L-003413-00-0005 ON-TARGETplus Human NFIA siRNA SMARTPool Dharmacon Cat# L-008661-00-0005 ON-TARGETplus Human PPARa siRNA SMARTPool Dharmacon Cat# L-003434-00-0005 ON-TARGETplus Human RARa siRNA SMARTPool Dharmacon Cat# L-003437-00-0005 ON-TARGETplus Human RXRa siRNA SMARTPool Dharmacon Cat# L-003443-00-0005 ON-TARGETplus Human SP1 siRNA SMARTPool Dharmacon Cat# L-026959-00-0005 ON-TARGETplus Human SREBP-1 siRNA SMARTPool Dharmacon Cat# L-006891-00-0005 ON-TARGETplus Human STAT1 siRNA SMARTPool Dharmacon Cat# L-003543-00-0005 ON-TARGETplus Human STAT4 siRNA SMARTPool Dharmacon Cat# L-011784-00-0005 ON-TARGETplus Human TBP siRNA SMARTPool Dharmacon Cat# L-011790-00-0005 ON-TARGETplus Human USF2 siRNA SMARTPool Dharmacon Cat# L-003618-00-0005 ON-TARGETplus Human VDR siRNA SMARTPool Dharmacon Cat# L-003448-00-0005 ON-TARGETplus Human XBP-1 siRNA SMARTPool Dharmacon Cat# L-009552-00-0005 In vivo: Snord46 sgRNA7 GGGUGCACAGACCCUGCACG Biocytogen Cat# EGE-LC-049 In vivo: Snord46 sgRNA14 UAGAACAUGGCCUUACUGGG Biocytogen Cat# EGE-LC-049 sgRNAs used in in vitro adipocytes This paper See Table S5; Genescript gRNA Design Tool Custom miRCURY LNA Power Inhibitors Qiagen See Table S5 PICh Capture Probes Fidelity Oligos See Table S5 qPCR Primers This paper See Table S5 miRCURY LNA miRNA Custom PCR Assays Qiagen See Table S5 miRCURY LNA miRNA Detection Probe Qiagen See Table S5 Synthetic Biotinylated RNA Integrated DNA Technologies See Table S5 Recombinant DNA pGEM-3Z-SNORD46 This paper N/A pGEM-3Z-Snord46 This paper N/A pLV-Puro-CMV>hC/EBPb wild-type and mutants This paper N/A (Continued on next page) e7 Cell Metabolism 35, 1457–1473.e1–e13, August 8, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pLV-Puro-Adipoq>hIL15 wild-type and mutants This paper N/A pLV-Puro-Adipoq>SNORD46 wild-type and mutants This paper N/A pLV-Puro-Adipoq>MGLL wild-type and mutants This paper N/A pLV-Puro-Adipoq>CD36 wild-type and mutants This paper N/A pET28a-IL15 wild-type and mutants GeneScript N/A; custom order pET28a-MGLL wild-type and mutants GeneScript N/A; custom order Software and Article Title: A spermidine riboswitch class in bacteria exploits a close variant of an aptamer for the enzyme cofactor S-adenosylmethionine. Article Snippet: .. Recombinant DNA pDG1661tsl Li et al.79 N/A pDG1661tsl-TilldcCWT GenScript N/A pDG1661tsl-TilldcCM1 GenScript N/A pDG1661tsl-TilldcCM2 GenScript N/A pDG1661tsl- TilldcCM3 GenScript N/A pDG1661tsl-TilldcCM4 GenScript N/A pDG1661tsl-TilldcCM5 GenScript N/A pDG1661tsl-TilldcCM6 GenScript N/A pDG1661tsl-TilldcCM7 GenScript N/A pDG1661tsl-TilldcCM8 GenScript N/A pDG1661tsl-TilconshypoWT GenScript N/A pDG1661tsl-TilconshypoM15 GenScript N/A Software and Article Title: PARylation of BRCA1 limits DNA break resection through BRCA2 and EXO1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human BRCA1 antibody [8F7] Genetex GTX70113; RRID: AB_368614 Mouse anti-human BRCA2 antibody (3D12) Santa-Cruz SC-293185 Goat anti-human BRCA2 antibody (C19) Santa-Cruz SC-1817; RRID: AB_630948 Rabbit anti-human 53BP1 antibody Cell Signaling 4937; RRID: AB_10694558 Rabbit anti-human EXO1 antibody Sigma-Aldrich SAB4503568; RRID: AB_10761635 Rabbit anti-human Poly/Mono-ADP Ribose (PAR) (E6F6A) antibody Cell Signaling 83732; RRID: AB_2749858 Rabbit anti-human RIF1 antibody Thermo Fischer Scientific PA5-57857; RRID: AB_2646559 Rabbit anti-human RAD51 antibody (Ab-1) Calbiochem PC-130; RRID: AB_2238184 Mouse anti-human CYCLIN-B1 antibody BD pharmingen 554176; RRID: AB_395287 Rabbit anti-human HPF1 antibody Sigma-Aldrich HPA043467; RRID: AB_10793949 Mouse anti-human CtIP antibody Active Motif 61141; RRID: AB_2714164 Bacterial and virus strains DH5alpha competent cells Thermo Fisher Scientific 18,265,017 Chemicals, peptides, and recombinant proteins Doxycycline Merck D9891 Bleomycin Merck B7216 Penicillin-Streptomycin Euroclone ECB3001 Hygromycin Genespin STS-HY1 Blasticidine Genespin STS-BLAS20 Formaldehyde Sigma-Aldrich P6148 Olaparib (AZD2281) Selleckchem S1060 BsrGI-HF NEB R3575S BamHI-HF NEB R3136S ddPCR Supermix for Probes (No dUTP) Bio-Rad 1,863,025 cOmpleteTM ULTRA Tablets, Mini, Protease Inhibitor Cocktail Roche 5,892,970,001 Proteinase K Amsbio 120,493–1 RNase A Sigma-Aldrich R6513 ProlongGold with DAPI Thermo Fischer Scientific P36931 Leica immersion oil type F Thermo Fischer Scientific 11,944,399 Critical commercial assays Qiagen Spin Miniprep Kit Qiagen 27,106 Lipofectamine RNAiMAX Transfection Reagent Thermo Fischer Scientific 13,778,150 Lipofectamine 2000 Transfection Reagent Thermo Fischer Scientific 11,668,019 NucleoSpin Tissue, Mini kit for DNA from cells and tissue Macherey-Nagel 740,952.250 NuPAGETM 4 to 12%, Bis-Tris, 1.5 mm, 10-well Thermo Fischer Scientific NP0335PK2 Clarity Western ECL Substrate Biorad 1,705,061 Droplet Generation Oil for Probes Biorad 1,863,005 Droplet generator gasket Biorad 1,863,009 Droplet Generator cartridge Biorad 1,864,008 (Continued on next page) 10 Cell Reports 42, 112060, February 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: U2OS Stably Expressing Cas9 Munoz et al.40 N/A Oligonucleotides For list of oligonucleotides, see Table S1 N/A N/A Recombinant DNA pcDNA3-BRCA1WT-HA Hu et al.16 N/A pcDNA3-BRCA1D5-HA Hu et al.16 N/A Software and Indirect Immunoperoxidase Assay:Article Title: Molecular mechanisms of snoRNA-IL-15 crosstalk in adipocyte lipolysis and NK cell rejuvenation. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus Human FOXP3 siRNA SMARTPool Dharmacon Cat# L-009307-00-0005 ON-TARGETplus Human GATA1 siRNA SMARTPool Dharmacon Cat# L-009610-00-0005 ON-TARGETplus Human GR siRNA SMARTPool Dharmacon Cat# L-003424-00-0005 ON-TARGETplus Human HIF1a siRNA SMARTPool Dharmacon Cat# L-004018-00-0005 ON-TARGETplus Human LXRa siRNA SMARTPool Dharmacon Cat# L-003413-00-0005 ON-TARGETplus Human NFIA siRNA SMARTPool Dharmacon Cat# L-008661-00-0005 ON-TARGETplus Human PPARa siRNA SMARTPool Dharmacon Cat# L-003434-00-0005 ON-TARGETplus Human RARa siRNA SMARTPool Dharmacon Cat# L-003437-00-0005 ON-TARGETplus Human RXRa siRNA SMARTPool Dharmacon Cat# L-003443-00-0005 ON-TARGETplus Human SP1 siRNA SMARTPool Dharmacon Cat# L-026959-00-0005 ON-TARGETplus Human SREBP-1 siRNA SMARTPool Dharmacon Cat# L-006891-00-0005 ON-TARGETplus Human STAT1 siRNA SMARTPool Dharmacon Cat# L-003543-00-0005 ON-TARGETplus Human STAT4 siRNA SMARTPool Dharmacon Cat# L-011784-00-0005 ON-TARGETplus Human TBP siRNA SMARTPool Dharmacon Cat# L-011790-00-0005 ON-TARGETplus Human USF2 siRNA SMARTPool Dharmacon Cat# L-003618-00-0005 ON-TARGETplus Human VDR siRNA SMARTPool Dharmacon Cat# L-003448-00-0005 ON-TARGETplus Human XBP-1 siRNA SMARTPool Dharmacon Cat# L-009552-00-0005 In vivo: Snord46 sgRNA7 GGGUGCACAGACCCUGCACG Biocytogen Cat# EGE-LC-049 In vivo: Snord46 sgRNA14 UAGAACAUGGCCUUACUGGG Biocytogen Cat# EGE-LC-049 sgRNAs used in in vitro adipocytes This paper See Table S5; Genescript gRNA Design Tool Custom miRCURY LNA Power Inhibitors Qiagen See Table S5 PICh Capture Probes Fidelity Oligos See Table S5 qPCR Primers This paper See Table S5 miRCURY LNA miRNA Custom PCR Assays Qiagen See Table S5 miRCURY LNA miRNA Detection Probe Qiagen See Table S5 Synthetic Biotinylated RNA Integrated DNA Technologies See Table S5 Recombinant DNA pGEM-3Z-SNORD46 This paper N/A pGEM-3Z-Snord46 This paper N/A pLV-Puro-CMV>hC/EBPb wild-type and mutants This paper N/A (Continued on next page) e7 Cell Metabolism 35, 1457–1473.e1–e13, August 8, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER pLV-Puro-Adipoq>hIL15 wild-type and mutants This paper N/A pLV-Puro-Adipoq>SNORD46 wild-type and mutants This paper N/A pLV-Puro-Adipoq>MGLL wild-type and mutants This paper N/A pLV-Puro-Adipoq>CD36 wild-type and mutants This paper N/A pET28a-IL15 wild-type and mutants GeneScript N/A; custom order pET28a-MGLL wild-type and mutants GeneScript N/A; custom order Software and Recombinant:Article Title: A spermidine riboswitch class in bacteria exploits a close variant of an aptamer for the enzyme cofactor S-adenosylmethionine. Article Snippet: .. Recombinant DNA pDG1661tsl Li et al.79 N/A pDG1661tsl-TilldcCWT GenScript N/A pDG1661tsl-TilldcCM1 GenScript N/A pDG1661tsl-TilldcCM2 GenScript N/A pDG1661tsl- TilldcCM3 GenScript N/A pDG1661tsl-TilldcCM4 GenScript N/A pDG1661tsl-TilldcCM5 GenScript N/A pDG1661tsl-TilldcCM6 GenScript N/A pDG1661tsl-TilldcCM7 GenScript N/A pDG1661tsl-TilldcCM8 GenScript N/A pDG1661tsl-TilconshypoWT GenScript N/A pDG1661tsl-TilconshypoM15 GenScript N/A Software and Article Title: Cholinergic signaling via muscarinic M1 receptor confers resistance to docetaxel in prostate cancer Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains J:NU (nude) mice Jackson Laboratory Cat# 007850 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice Jackson Laboratory Cat# 005557 Oligonucleotides Human ChAT siRNA Santa Cruz Biotech Cat# sc-41919 Human b-arrestin-2 siRNA Santa Cruz Biotech Cat# sc-29208 Human CHRM1 siRNA Origene Cat# SR300807 Control siRNA Santa Cruz Biotech Cat# sc-37007 Recombinant DNA pLVX-AcGFP1-N1 Takara Bio Cat# 632154 pCMV-33FLAG-Myc Sigma-Aldrich Cat# E6401 pLVX-CHRM1 This paper N/A pLVX-CHRM1-L167A This paper N/A pLVX-CHRM1-C391A This paper N/A pLVX-CHRM1-C394A This paper N/A pLVX-CHRM1-P396A This paper N/A pLVX-hM1Dq Armbruster et al. 25 and this paper N/A pLVX-FLAG-hM1Dq This paper N/A pCMV-myc-ERK2-L4A-MEK1 fusion Robinson et al.28 RRID: Addgene_39197 pcw107-FLAG-MKK7-JNK2 fusion Martz et al.29 RRID: Addgene_64618 pcDNA3-FLAG-MKK6 (Glu) Raingeaud et al.30 RRID: Addgene_13518 pCMV delta R8.2 Dr. Didier Trono Lab (Swiss Federal Institute of Technology Lausanne, Lausanne, Switzerland) RRID: Addgene_12263 pCMV-VSV-G Stewart et al.59 RRID: Addgene_8454 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Image Lab 6.1 Bio-Rad Laboratories https://www.bio-rad.com/en-us/ product/image-lab-software HALO Indica Labs https://indicalab.com/halo/ GSEA v4.0.3 Subramanian et al.60 https://www.gsea-msigdb.org/ GraphPad Prism 9 GraphPad https://www.graphpad.com/ Bowtie 2 v2.1.0 SourceForge https://bowtie-bio.sourceforge.net/ RSEM v1.2.15 Li and Dewey61 https://deweylab.github.io/RSEM/ AlphaFold Protein Structure Database Varadi et al.62 https://alphafold.ebi.ac.uk/entry Molecular Operating Environment (MOE) v2020.9 Chemical Computing Group ULC42 https://www.chemcomp.com/ Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains J:NU (nude) mice Jackson Laboratory Cat# 007850 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice Jackson Laboratory Cat# 005557 Oligonucleotides Human ChAT siRNA Santa Cruz Biotech Cat# sc-41919 Human b-arrestin-2 siRNA Santa Cruz Biotech Cat# sc-29208 Human CHRM1 siRNA Origene Cat# SR300807 Control siRNA Santa Cruz Biotech Cat# sc-37007 Recombinant DNA pLVX-AcGFP1-N1 Takara Bio Cat# 632154 pCMV-33FLAG-Myc Sigma-Aldrich Cat# E6401 pLVX-CHRM1 This paper N/A pLVX-CHRM1-L167A This paper N/A pLVX-CHRM1-C391A This paper N/A pLVX-CHRM1-C394A This paper N/A pLVX-CHRM1-P396A This paper N/A pLVX-hM1Dq Armbruster et al. 25 and this paper N/A pLVX-FLAG-hM1Dq This paper N/A pCMV-myc-ERK2-L4A-MEK1 fusion Robinson et al.28 RRID: Addgene_39197 pcw107-FLAG-MKK7-JNK2 fusion Martz et al.29 RRID: Addgene_64618 pcDNA3-FLAG-MKK6 (Glu) Raingeaud et al.30 RRID: Addgene_13518 pCMV delta R8.2 Dr. Didier Trono Lab (Swiss Federal Institute of Technology Lausanne, Lausanne, Switzerland) RRID: Addgene_12263 pCMV-VSV-G Stewart et al.59 RRID: Addgene_8454 Software and Article Title: PARylation of BRCA1 limits DNA break resection through BRCA2 and EXO1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human BRCA1 antibody [8F7] Genetex GTX70113; RRID: AB_368614 Mouse anti-human BRCA2 antibody (3D12) Santa-Cruz SC-293185 Goat anti-human BRCA2 antibody (C19) Santa-Cruz SC-1817; RRID: AB_630948 Rabbit anti-human 53BP1 antibody Cell Signaling 4937; RRID: AB_10694558 Rabbit anti-human EXO1 antibody Sigma-Aldrich SAB4503568; RRID: AB_10761635 Rabbit anti-human Poly/Mono-ADP Ribose (PAR) (E6F6A) antibody Cell Signaling 83732; RRID: AB_2749858 Rabbit anti-human RIF1 antibody Thermo Fischer Scientific PA5-57857; RRID: AB_2646559 Rabbit anti-human RAD51 antibody (Ab-1) Calbiochem PC-130; RRID: AB_2238184 Mouse anti-human CYCLIN-B1 antibody BD pharmingen 554176; RRID: AB_395287 Rabbit anti-human HPF1 antibody Sigma-Aldrich HPA043467; RRID: AB_10793949 Mouse anti-human CtIP antibody Active Motif 61141; RRID: AB_2714164 Bacterial and virus strains DH5alpha competent cells Thermo Fisher Scientific 18,265,017 Chemicals, peptides, and recombinant proteins Doxycycline Merck D9891 Bleomycin Merck B7216 Penicillin-Streptomycin Euroclone ECB3001 Hygromycin Genespin STS-HY1 Blasticidine Genespin STS-BLAS20 Formaldehyde Sigma-Aldrich P6148 Olaparib (AZD2281) Selleckchem S1060 BsrGI-HF NEB R3575S BamHI-HF NEB R3136S ddPCR Supermix for Probes (No dUTP) Bio-Rad 1,863,025 cOmpleteTM ULTRA Tablets, Mini, Protease Inhibitor Cocktail Roche 5,892,970,001 Proteinase K Amsbio 120,493–1 RNase A Sigma-Aldrich R6513 ProlongGold with DAPI Thermo Fischer Scientific P36931 Leica immersion oil type F Thermo Fischer Scientific 11,944,399 Critical commercial assays Qiagen Spin Miniprep Kit Qiagen 27,106 Lipofectamine RNAiMAX Transfection Reagent Thermo Fischer Scientific 13,778,150 Lipofectamine 2000 Transfection Reagent Thermo Fischer Scientific 11,668,019 NucleoSpin Tissue, Mini kit for DNA from cells and tissue Macherey-Nagel 740,952.250 NuPAGETM 4 to 12%, Bis-Tris, 1.5 mm, 10-well Thermo Fischer Scientific NP0335PK2 Clarity Western ECL Substrate Biorad 1,705,061 Droplet Generation Oil for Probes Biorad 1,863,005 Droplet generator gasket Biorad 1,863,009 Droplet Generator cartridge Biorad 1,864,008 (Continued on next page) 10 Cell Reports 42, 112060, February 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: U2OS Stably Expressing Cas9 Munoz et al.40 N/A Oligonucleotides For list of oligonucleotides, see Table S1 N/A N/A Recombinant DNA pcDNA3-BRCA1WT-HA Hu et al.16 N/A pcDNA3-BRCA1D5-HA Hu et al.16 N/A Software and Control:Article Title: Cholinergic signaling via muscarinic M1 receptor confers resistance to docetaxel in prostate cancer Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains J:NU (nude) mice Jackson Laboratory Cat# 007850 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice Jackson Laboratory Cat# 005557 Oligonucleotides Human ChAT siRNA Santa Cruz Biotech Cat# sc-41919 Human b-arrestin-2 siRNA Santa Cruz Biotech Cat# sc-29208 Human CHRM1 siRNA Origene Cat# SR300807 Control siRNA Santa Cruz Biotech Cat# sc-37007 Recombinant DNA pLVX-AcGFP1-N1 Takara Bio Cat# 632154 pCMV-33FLAG-Myc Sigma-Aldrich Cat# E6401 pLVX-CHRM1 This paper N/A pLVX-CHRM1-L167A This paper N/A pLVX-CHRM1-C391A This paper N/A pLVX-CHRM1-C394A This paper N/A pLVX-CHRM1-P396A This paper N/A pLVX-hM1Dq Armbruster et al. 25 and this paper N/A pLVX-FLAG-hM1Dq This paper N/A pCMV-myc-ERK2-L4A-MEK1 fusion Robinson et al.28 RRID: Addgene_39197 pcw107-FLAG-MKK7-JNK2 fusion Martz et al.29 RRID: Addgene_64618 pcDNA3-FLAG-MKK6 (Glu) Raingeaud et al.30 RRID: Addgene_13518 pCMV delta R8.2 Dr. Didier Trono Lab (Swiss Federal Institute of Technology Lausanne, Lausanne, Switzerland) RRID: Addgene_12263 pCMV-VSV-G Stewart et al.59 RRID: Addgene_8454 Software and algorithms ImageJ NIH https://imagej.nih.gov/ij/ Image Lab 6.1 Bio-Rad Laboratories https://www.bio-rad.com/en-us/ product/image-lab-software HALO Indica Labs https://indicalab.com/halo/ GSEA v4.0.3 Subramanian et al.60 https://www.gsea-msigdb.org/ GraphPad Prism 9 GraphPad https://www.graphpad.com/ Bowtie 2 v2.1.0 SourceForge https://bowtie-bio.sourceforge.net/ RSEM v1.2.15 Li and Dewey61 https://deweylab.github.io/RSEM/ AlphaFold Protein Structure Database Varadi et al.62 https://alphafold.ebi.ac.uk/entry Molecular Operating Environment (MOE) v2020.9 Chemical Computing Group ULC42 https://www.chemcomp.com/ Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains J:NU (nude) mice Jackson Laboratory Cat# 007850 NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice Jackson Laboratory Cat# 005557 Oligonucleotides Human ChAT siRNA Santa Cruz Biotech Cat# sc-41919 Human b-arrestin-2 siRNA Santa Cruz Biotech Cat# sc-29208 Human CHRM1 siRNA Origene Cat# SR300807 Control siRNA Santa Cruz Biotech Cat# sc-37007 Recombinant DNA pLVX-AcGFP1-N1 Takara Bio Cat# 632154 pCMV-33FLAG-Myc Sigma-Aldrich Cat# E6401 pLVX-CHRM1 This paper N/A pLVX-CHRM1-L167A This paper N/A pLVX-CHRM1-C391A This paper N/A pLVX-CHRM1-C394A This paper N/A pLVX-CHRM1-P396A This paper N/A pLVX-hM1Dq Armbruster et al. 25 and this paper N/A pLVX-FLAG-hM1Dq This paper N/A pCMV-myc-ERK2-L4A-MEK1 fusion Robinson et al.28 RRID: Addgene_39197 pcw107-FLAG-MKK7-JNK2 fusion Martz et al.29 RRID: Addgene_64618 pcDNA3-FLAG-MKK6 (Glu) Raingeaud et al.30 RRID: Addgene_13518 pCMV delta R8.2 Dr. Didier Trono Lab (Swiss Federal Institute of Technology Lausanne, Lausanne, Switzerland) RRID: Addgene_12263 pCMV-VSV-G Stewart et al.59 RRID: Addgene_8454 Software and Stable Transfection:Article Title: PARylation of BRCA1 limits DNA break resection through BRCA2 and EXO1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human BRCA1 antibody [8F7] Genetex GTX70113; RRID: AB_368614 Mouse anti-human BRCA2 antibody (3D12) Santa-Cruz SC-293185 Goat anti-human BRCA2 antibody (C19) Santa-Cruz SC-1817; RRID: AB_630948 Rabbit anti-human 53BP1 antibody Cell Signaling 4937; RRID: AB_10694558 Rabbit anti-human EXO1 antibody Sigma-Aldrich SAB4503568; RRID: AB_10761635 Rabbit anti-human Poly/Mono-ADP Ribose (PAR) (E6F6A) antibody Cell Signaling 83732; RRID: AB_2749858 Rabbit anti-human RIF1 antibody Thermo Fischer Scientific PA5-57857; RRID: AB_2646559 Rabbit anti-human RAD51 antibody (Ab-1) Calbiochem PC-130; RRID: AB_2238184 Mouse anti-human CYCLIN-B1 antibody BD pharmingen 554176; RRID: AB_395287 Rabbit anti-human HPF1 antibody Sigma-Aldrich HPA043467; RRID: AB_10793949 Mouse anti-human CtIP antibody Active Motif 61141; RRID: AB_2714164 Bacterial and virus strains DH5alpha competent cells Thermo Fisher Scientific 18,265,017 Chemicals, peptides, and recombinant proteins Doxycycline Merck D9891 Bleomycin Merck B7216 Penicillin-Streptomycin Euroclone ECB3001 Hygromycin Genespin STS-HY1 Blasticidine Genespin STS-BLAS20 Formaldehyde Sigma-Aldrich P6148 Olaparib (AZD2281) Selleckchem S1060 BsrGI-HF NEB R3575S BamHI-HF NEB R3136S ddPCR Supermix for Probes (No dUTP) Bio-Rad 1,863,025 cOmpleteTM ULTRA Tablets, Mini, Protease Inhibitor Cocktail Roche 5,892,970,001 Proteinase K Amsbio 120,493–1 RNase A Sigma-Aldrich R6513 ProlongGold with DAPI Thermo Fischer Scientific P36931 Leica immersion oil type F Thermo Fischer Scientific 11,944,399 Critical commercial assays Qiagen Spin Miniprep Kit Qiagen 27,106 Lipofectamine RNAiMAX Transfection Reagent Thermo Fischer Scientific 13,778,150 Lipofectamine 2000 Transfection Reagent Thermo Fischer Scientific 11,668,019 NucleoSpin Tissue, Mini kit for DNA from cells and tissue Macherey-Nagel 740,952.250 NuPAGETM 4 to 12%, Bis-Tris, 1.5 mm, 10-well Thermo Fischer Scientific NP0335PK2 Clarity Western ECL Substrate Biorad 1,705,061 Droplet Generation Oil for Probes Biorad 1,863,005 Droplet generator gasket Biorad 1,863,009 Droplet Generator cartridge Biorad 1,864,008 (Continued on next page) 10 Cell Reports 42, 112060, February 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: U2OS Stably Expressing Cas9 Munoz et al.40 N/A Oligonucleotides For list of oligonucleotides, see Table S1 N/A N/A Recombinant DNA pcDNA3-BRCA1WT-HA Hu et al.16 N/A pcDNA3-BRCA1D5-HA Hu et al.16 N/A Software and Expressing:Article Title: PARylation of BRCA1 limits DNA break resection through BRCA2 and EXO1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human BRCA1 antibody [8F7] Genetex GTX70113; RRID: AB_368614 Mouse anti-human BRCA2 antibody (3D12) Santa-Cruz SC-293185 Goat anti-human BRCA2 antibody (C19) Santa-Cruz SC-1817; RRID: AB_630948 Rabbit anti-human 53BP1 antibody Cell Signaling 4937; RRID: AB_10694558 Rabbit anti-human EXO1 antibody Sigma-Aldrich SAB4503568; RRID: AB_10761635 Rabbit anti-human Poly/Mono-ADP Ribose (PAR) (E6F6A) antibody Cell Signaling 83732; RRID: AB_2749858 Rabbit anti-human RIF1 antibody Thermo Fischer Scientific PA5-57857; RRID: AB_2646559 Rabbit anti-human RAD51 antibody (Ab-1) Calbiochem PC-130; RRID: AB_2238184 Mouse anti-human CYCLIN-B1 antibody BD pharmingen 554176; RRID: AB_395287 Rabbit anti-human HPF1 antibody Sigma-Aldrich HPA043467; RRID: AB_10793949 Mouse anti-human CtIP antibody Active Motif 61141; RRID: AB_2714164 Bacterial and virus strains DH5alpha competent cells Thermo Fisher Scientific 18,265,017 Chemicals, peptides, and recombinant proteins Doxycycline Merck D9891 Bleomycin Merck B7216 Penicillin-Streptomycin Euroclone ECB3001 Hygromycin Genespin STS-HY1 Blasticidine Genespin STS-BLAS20 Formaldehyde Sigma-Aldrich P6148 Olaparib (AZD2281) Selleckchem S1060 BsrGI-HF NEB R3575S BamHI-HF NEB R3136S ddPCR Supermix for Probes (No dUTP) Bio-Rad 1,863,025 cOmpleteTM ULTRA Tablets, Mini, Protease Inhibitor Cocktail Roche 5,892,970,001 Proteinase K Amsbio 120,493–1 RNase A Sigma-Aldrich R6513 ProlongGold with DAPI Thermo Fischer Scientific P36931 Leica immersion oil type F Thermo Fischer Scientific 11,944,399 Critical commercial assays Qiagen Spin Miniprep Kit Qiagen 27,106 Lipofectamine RNAiMAX Transfection Reagent Thermo Fischer Scientific 13,778,150 Lipofectamine 2000 Transfection Reagent Thermo Fischer Scientific 11,668,019 NucleoSpin Tissue, Mini kit for DNA from cells and tissue Macherey-Nagel 740,952.250 NuPAGETM 4 to 12%, Bis-Tris, 1.5 mm, 10-well Thermo Fischer Scientific NP0335PK2 Clarity Western ECL Substrate Biorad 1,705,061 Droplet Generation Oil for Probes Biorad 1,863,005 Droplet generator gasket Biorad 1,863,009 Droplet Generator cartridge Biorad 1,864,008 (Continued on next page) 10 Cell Reports 42, 112060, February 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: U2OS Stably Expressing Cas9 Munoz et al.40 N/A Oligonucleotides For list of oligonucleotides, see Table S1 N/A N/A Recombinant DNA pcDNA3-BRCA1WT-HA Hu et al.16 N/A pcDNA3-BRCA1D5-HA Hu et al.16 N/A Software and Digital PCR:Article Title: PARylation of BRCA1 limits DNA break resection through BRCA2 and EXO1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human BRCA1 antibody [8F7] Genetex GTX70113; RRID: AB_368614 Mouse anti-human BRCA2 antibody (3D12) Santa-Cruz SC-293185 Goat anti-human BRCA2 antibody (C19) Santa-Cruz SC-1817; RRID: AB_630948 Rabbit anti-human 53BP1 antibody Cell Signaling 4937; RRID: AB_10694558 Rabbit anti-human EXO1 antibody Sigma-Aldrich SAB4503568; RRID: AB_10761635 Rabbit anti-human Poly/Mono-ADP Ribose (PAR) (E6F6A) antibody Cell Signaling 83732; RRID: AB_2749858 Rabbit anti-human RIF1 antibody Thermo Fischer Scientific PA5-57857; RRID: AB_2646559 Rabbit anti-human RAD51 antibody (Ab-1) Calbiochem PC-130; RRID: AB_2238184 Mouse anti-human CYCLIN-B1 antibody BD pharmingen 554176; RRID: AB_395287 Rabbit anti-human HPF1 antibody Sigma-Aldrich HPA043467; RRID: AB_10793949 Mouse anti-human CtIP antibody Active Motif 61141; RRID: AB_2714164 Bacterial and virus strains DH5alpha competent cells Thermo Fisher Scientific 18,265,017 Chemicals, peptides, and recombinant proteins Doxycycline Merck D9891 Bleomycin Merck B7216 Penicillin-Streptomycin Euroclone ECB3001 Hygromycin Genespin STS-HY1 Blasticidine Genespin STS-BLAS20 Formaldehyde Sigma-Aldrich P6148 Olaparib (AZD2281) Selleckchem S1060 BsrGI-HF NEB R3575S BamHI-HF NEB R3136S ddPCR Supermix for Probes (No dUTP) Bio-Rad 1,863,025 cOmpleteTM ULTRA Tablets, Mini, Protease Inhibitor Cocktail Roche 5,892,970,001 Proteinase K Amsbio 120,493–1 RNase A Sigma-Aldrich R6513 ProlongGold with DAPI Thermo Fischer Scientific P36931 Leica immersion oil type F Thermo Fischer Scientific 11,944,399 Critical commercial assays Qiagen Spin Miniprep Kit Qiagen 27,106 Lipofectamine RNAiMAX Transfection Reagent Thermo Fischer Scientific 13,778,150 Lipofectamine 2000 Transfection Reagent Thermo Fischer Scientific 11,668,019 NucleoSpin Tissue, Mini kit for DNA from cells and tissue Macherey-Nagel 740,952.250 NuPAGETM 4 to 12%, Bis-Tris, 1.5 mm, 10-well Thermo Fischer Scientific NP0335PK2 Clarity Western ECL Substrate Biorad 1,705,061 Droplet Generation Oil for Probes Biorad 1,863,005 Droplet generator gasket Biorad 1,863,009 Droplet Generator cartridge Biorad 1,864,008 (Continued on next page) 10 Cell Reports 42, 112060, February 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: U2OS Stably Expressing Cas9 Munoz et al.40 N/A Oligonucleotides For list of oligonucleotides, see Table S1 N/A N/A Recombinant DNA pcDNA3-BRCA1WT-HA Hu et al.16 N/A pcDNA3-BRCA1D5-HA Hu et al.16 N/A Software and Microscopy:Article Title: PARylation of BRCA1 limits DNA break resection through BRCA2 and EXO1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-human BRCA1 antibody [8F7] Genetex GTX70113; RRID: AB_368614 Mouse anti-human BRCA2 antibody (3D12) Santa-Cruz SC-293185 Goat anti-human BRCA2 antibody (C19) Santa-Cruz SC-1817; RRID: AB_630948 Rabbit anti-human 53BP1 antibody Cell Signaling 4937; RRID: AB_10694558 Rabbit anti-human EXO1 antibody Sigma-Aldrich SAB4503568; RRID: AB_10761635 Rabbit anti-human Poly/Mono-ADP Ribose (PAR) (E6F6A) antibody Cell Signaling 83732; RRID: AB_2749858 Rabbit anti-human RIF1 antibody Thermo Fischer Scientific PA5-57857; RRID: AB_2646559 Rabbit anti-human RAD51 antibody (Ab-1) Calbiochem PC-130; RRID: AB_2238184 Mouse anti-human CYCLIN-B1 antibody BD pharmingen 554176; RRID: AB_395287 Rabbit anti-human HPF1 antibody Sigma-Aldrich HPA043467; RRID: AB_10793949 Mouse anti-human CtIP antibody Active Motif 61141; RRID: AB_2714164 Bacterial and virus strains DH5alpha competent cells Thermo Fisher Scientific 18,265,017 Chemicals, peptides, and recombinant proteins Doxycycline Merck D9891 Bleomycin Merck B7216 Penicillin-Streptomycin Euroclone ECB3001 Hygromycin Genespin STS-HY1 Blasticidine Genespin STS-BLAS20 Formaldehyde Sigma-Aldrich P6148 Olaparib (AZD2281) Selleckchem S1060 BsrGI-HF NEB R3575S BamHI-HF NEB R3136S ddPCR Supermix for Probes (No dUTP) Bio-Rad 1,863,025 cOmpleteTM ULTRA Tablets, Mini, Protease Inhibitor Cocktail Roche 5,892,970,001 Proteinase K Amsbio 120,493–1 RNase A Sigma-Aldrich R6513 ProlongGold with DAPI Thermo Fischer Scientific P36931 Leica immersion oil type F Thermo Fischer Scientific 11,944,399 Critical commercial assays Qiagen Spin Miniprep Kit Qiagen 27,106 Lipofectamine RNAiMAX Transfection Reagent Thermo Fischer Scientific 13,778,150 Lipofectamine 2000 Transfection Reagent Thermo Fischer Scientific 11,668,019 NucleoSpin Tissue, Mini kit for DNA from cells and tissue Macherey-Nagel 740,952.250 NuPAGETM 4 to 12%, Bis-Tris, 1.5 mm, 10-well Thermo Fischer Scientific NP0335PK2 Clarity Western ECL Substrate Biorad 1,705,061 Droplet Generation Oil for Probes Biorad 1,863,005 Droplet generator gasket Biorad 1,863,009 Droplet Generator cartridge Biorad 1,864,008 (Continued on next page) 10 Cell Reports 42, 112060, February 28, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines Human: U2OS Stably Expressing Cas9 Munoz et al.40 N/A Oligonucleotides For list of oligonucleotides, see Table S1 N/A N/A Recombinant DNA pcDNA3-BRCA1WT-HA Hu et al.16 N/A pcDNA3-BRCA1D5-HA Hu et al.16 N/A Software and |